DeCure for Ullrich congenital muscular dystrophy 1B
DeCure's autonomous Rare AI scientist is researching a drug-repurposing hypothesis for Ullrich congenital muscular dystrophy 1B — screening already-approved drugs against its 1-gene Open Targets disease module to publish open-access research. Research is fast; the path to publication is funded in milestone stages.
Disease moduleUllrich congenital muscular dystrophy 1B maps to a 1-gene Open Targets module — the target space DeCure's AI scientist screens approved drugs against.
DeCure.ai methodSignature reversal (LINCS) plus network proximity (STRING) rank already-approved drugs likely to perturb this module — the same engine that produces DeCure.ai's repurposing hypotheses.
Repurposing thesisScreening approved medicines against this disease module, then publishing the evidence for the strongest candidate. Known pharmacology and human exposure data make the first question sharper — they do not establish safety or efficacy in a new indication.
Research record
01
ResearchComing soon
Candidate research + dossier — target rationale, drug-repurposing thesis and evidence pack.proof: Published dossier + on-chain hash
02
ValidationComing soon
In-vitro biological validation at a contract research org (CRO).proof: CRO contract + in-vitro report
03
Peer review & paperComing soon
Peer-reviewed paper published open-access (preprint + journal).proof: DOI + open-access link + on-chain hash
Current lead
No approved-drug candidate for ullrich congenital muscular dystrophy 1b is corroborated in the literature DeepSearch retrieved. Some conditions are managed with non-pharmacological care — a device, surgery or physical therapy — rather than a medicine; that may be the case here, or the literature we found may simply be too sparse yet to support a drug-repurposing angle.
Molecular view
collagen type VI alpha 2 chain (COL6A2) — COL6A2 is one of the genes genetically linked to this disease in Open Targets — shown as context, not as a drug target we're pursuing: no approved-drug candidate for this disease is yet corroborated in the literature we found.
Loading structure…
helix sheet apo structuredrag to rotate · scroll to zoom
RCSB Protein Data Bank · entry 9GTU · 3.14 Å · ligand none (apo structure). Experimental structure, not a prediction.
What the evidence adds up to
Ullrich congenital muscular dystrophy is caused by mutations in one of three genes encoding collagen VI: COL6A1, COL6A2, or COL6A3. A 2004 report on eight patients described a distinct abnormality in which collagen was present in the interstitium but absent from the sarcolemma, suggesting that failure of collagen VI to anchor the basal lamina to the interstitium can cause the disease. A 2018 study identified novel recessive mutations in COL6A1 in a patient with the early-severe phenotype, which is divided from other subtypes mainly according to ambulation status. A 2024 report of two unrelated Yakut families found the cause in the first family to be two compound heterozygous mutations in COL6A2 (c.1561C>T and c.2329T>C), and in the second family a homozygous c.2329T>C mutation in COL6A2. The clinical picture in those families included muscle weakness and hypotonia, hypermobility of the interphalangeal joints, contractures of the elbow, ankle and knee joints, delayed motor development, spinal deformity, and skin changes; inheritance was autosomal recessive.
No therapeutic trials or pharmacologic interventions specific to Ullrich congenital muscular dystrophy were reported in any of these abstracts. A 2013 review of therapeutic advances in muscular dystrophy discussed only Duchenne muscular dystrophy, facioscapulohumeral muscular dystrophy, and myotonic dystrophy, and did not mention Ullrich CMD or any drug tested in it. That review noted a large number of novel pharmacologic agents in development with good biologic rationale and strong proof of concept for the three disorders it covered, but this does not extend to Ullrich CMD.
The 2024 report states that next-generation sequencing techniques make diagnosis easier, and that neurologists and geneticists should be alert to Ullrich CMD when identifying symptoms of myopathy, delayed motor development, and hypermobility in distal joints contrasting with retractions of proximal and axial joints. No survival rates, response rates, or sample sizes beyond the eight patients in 2004 and the two families in 2024 were provided in these abstracts. What remains missing are any clinical trials of drugs for Ullrich CMD, funding for such trials, and any identified patient stratification beyond the broad phenotypic severity division by ambulation status.
Evidence
Retrieved by DeepSearch across 234,678,978 indexed works and resolved on OpenAlex — ranked by citations, including the results that did not work.
Annals of Neurology · 2013 · 79 citations · open access
Therapeutic advances in muscular dystrophy
AbstractThe muscular dystrophies comprise a heterogeneous group of genetic disorders that produce progressive skeletal muscle weakness and wasting. There has been rapid growth and change in our understanding of these disorders in recent years, and advances in basic science are being translated into increasing numbers of clinical trials. This review will discuss therapeutic developments in 3 of the most common forms of muscular dystrophy: Duchenne muscular dystrophy, facioscapulohumeral muscular dystrophy, and myotonic dystrophy. Each of these disorders represents a different class of genetic disease (monogenic, epigenetic, and repeat expansion disorders), and the approach to therapy addresses the diverse and complex molecular mechanisms involved in these diseases. The large number of novel pharmacologic agents in development with good biologic rationale and strong proof of concept suggests there will be an improved quality of life for individuals with muscular dystrophy.
AbstractSarcolemma-specific collagen VI deficiency in Ullrich diseaseMutations in collagen VI are a cause of the severe congenital muscular dystrophy, Ullrich disease.Ishikawa et al. report eight patients with Ullrich disease with a different abnormality: collagen was present in the interstitium but absent from the sarcolemma.They suggest that the failure of collagen VI to anchor the basal lamina to the interstitium can cause Ullrich disease.
Annals of Clinical Neurophysiology · 2018 · 0 citations · open access
Novel recessive mutations of <i>COL6A1</i> identified in the early severe phenotype of ullrich congenital muscular dystrophy
AbstractUllrich congenital muscular dystrophy (UCMD) is caused by mutations in one of three genes encoding collagen VI. Although UCMD usually shows an early onset, progressive weakness, contractures and hyperlaxity of the joints, and respiratory failure, it is well known to exhibit a wide spectrum of clinical severities. The severities of the phenotypic subtypes are mainly divided according to the ambulation status. We report a patient with the early-severe phenotype of UCMD who was diagnosed by the detection of novel recessive mutations in COL6A1.
Yakut Medical Journal · 2024 · 0 citations · open access
Ullrich congenital muscular dystrophy: clinical case study
AbstractIntroduction. Ullrich congenital muscular dystrophy (Ullrich СMD, OMIM #254090) is the most severe form of skeletal muscle collagenopathy associated with three genes (COL6A1, COL6A2, COL6A3). The purpose of the report was to present our own observation of clinical cases with Ullrich congenital muscular dystrophy in two unrelated Yakut families. Materials and methods. A clinical and genealogical examination, electroneuromyography, muscle MRI, muscle biopsy, and molecular genetic research using the massively parallel sequencing method were carried out. Results. The cause of the disease in the first family was two mutations in a compound heterozygous state: c.1561C>T and c.2329T>C in the COL6A2 gene; in the second family, the c.2329T>C mutation in the COL6A2 gene in a homozygous state. The clinical picture of the disease was manifested by muscle weakness and hypotonia, hypermobility of the interphalangeal joints, contractures of the elbow, ankle and knee joints, delayed motor development, spinal deformity, and skin changes. The type of inheritance in families is autosomal recessive. Conclusions. Despite the rarity of the disease, neurologists and geneticists, when identifying symptoms of myopathy, delayed motor development, and the presence of hypermobility in the distal joints, contrasting with retractions of the proximal and axial joints, must be alert to Ullrich CMD. Next-generation sequencing techniques make it easier to diagnose the disease. Keywords: congenital muscular dystrophy, Ullrich's disease, COL6A2, Yakut family, clinical case.
Unexpected partial RNA deletion by two different novel <i>COL6A2</i> mutations leads to Ullrich congenital muscular dystrophy
AbstractWe described novel compound heterozygous pathogenic mutations of COL6A2. Results demonstrated that two different novel mutations may together contribute to the partial deletion at the beginning sequences of the same exon 26. This might be attributed to the defective pre-mRNA splicing and phenotype caused only when both mutations are present. The 9-year-old boy (II-2, Figure 1A) was the second child of healthy non-consanguineous parents. The patient presented myasthenia and was initially diagnosed with Ullrich congenital muscular dystrophy (UCMD). Physical examination shows bilateral lower extremity weakness, the inability to stand and the left positive Babinski sign. The proband presented equinus when he stood with auxiliary assistance. Auxiliary examinations yield the following results: biochemical assays were as follows: creatine kinase isoenzyme 12.03 ng/ml; creatinine 19 µmol/l; creatine kinase 370 U/l. On the biceps brachii, vastus medialis and anterior muscle, needle electromyography revealed that the duration of voluntary motor unit potential on volition was reduced by 32%, 27% and 38%, respectively. The left biceps brachii muscle biopsy was performed Figure 1B. The pathological outcome was the atrophy of both types of fibers. Part of the muscle fiber was replaced by connective and adipose tissues, and the size of the remaining muscle fiber was noticeably different. Immunohistochemistry results indicated that dystrophin-Rod, dystrophin-N and β-sarcoglycan were reduced in muscle fiber membranes. A proportion of muscle fiber membranes were absent of dystrophin-C reporter staining. Collectively, the proband is highly probable to have muscular dystrophy, and genetic testing is extremely helpful for disease diagnosis. Genetic and pathological findings of the proband and his parents. (A) Pedigree of the family with UCMD. The black arrow denotes the proband. (B) Hematoxylin and eosin staining results demonstrate that part of the muscle fiber is replaced with connective and adipose tissues; the sizes are significantly different in the remaining myofibers. Fragmenting and hypercontracted myofibers are visible. The number of fibers with internal nuclei and nuclear bags were evidently increased. The immunohistochemical results indicate that the staining of myofiber membranes is diffusely weakened and even absent (100 μm). (C) The partial DNA sequence chromatograms of splice site mutations in COL6A2. The frameshift mutation (c.1970-10_1978delCGGCTTGCAGGGACGCGTG) in the proband and his mother. The splice site mutation (c.2462-3C>A) in the proband and his father. The black arrows denote the mutation site. (D) Partial RNA sequence chromatograms of the frameshift mutation in COL6A2 show a 23 bp-deletion (GGACGCGTGTGGGCGTGGTGCAG) compared to wild-type. The black arrow indicates the start of the deletion site. Whole-exome sequencing (WES) results indicate that the proband carries two novel compound heterozygous pathogenic mutations in COL6A2: a frameshift mutation (NM 001849.3: c.1970-17_1971 del ACGCGTGCGGCTTGCAGGG) and a splice site mutation (NM 001849.3: c.2462-3C>A) (Figure 1C). Subsequently, the mutations of COL6A2 in the proband, his parents, and his sibling were validated by Sanger sequencing. Notably, the frameshift mutation (c.1970-10_1978 del CGGCTTGCAGGGACGCGTG) was confirmed at the DNA level in the proband and his mother by Sanger sequencing and was different from the WES results Moreover, another site was observed in the father and proband. The mode of inheritance complies with the rules of autosomal dominant inheritance. The mRNA was extracted from the peripheral blood to further verify the functional effect of the genetic variants. RNA sequence analyses showed wild-type sequences in the parents and sibling. However, the proband has a homozygous but unusual sequence, a 23 bp (c.2462–2484 del GGACGCGTGTGGGCGTGGTGCAG) deletion at the beginning of exon 26 compared to wild-type (Figure 1D). We speculated that mutations affect the phenotype only when two mutations are present together. Zhang et al.4 reported two UCMD patients with different mutations in COL6A2; one carried a homozygous c.1870G>A (p.E624K) variant and the other a homozygous c.2626C>A (p.R876S). Both patients presented with myasthenia, joint contractures and joint laxity. Lucarini et al.5 reported a proband who carried a homozygous A > G mutation at −10 of intron 12 in COL6A2 that goes along with generalized muscle weakness, arthrogryposis and mild spine rigidity. In our study, we described a UCMD proband with slowly progressive muscle weakness of the limb-girdle muscles and identified novel compound heterozygous pathogenic mutations of COL6A2 in a Chinese family. Subsequently, we directly extracted RNA from peripheral blood to verify the effect of the two different novel types of COL6A2 mutations at the mRNA level. Our results demonstrated that the proband carried a homozygous aberrant mRNA sequence, suggesting that two different novel mutations may together contribute to the partial deletion at the beginning sequences of the same exon 26. This might be attributed to the defective pre-mRNA splicing and phenotype caused only when both mutations are present, indicating that RNA sequencing is also essential to diagnose the disease. However, the action mechanism of those mutations is not entirely clear. Therefore, an ideal method combining DNA and RNA sequencing has been suggested as an optimal tool for prenatal diagnosis. In summary, our research demonstrated the novel pathogenicity of mutations and expanded the variant spectrum of COL6A2, further improving the accurate diagnosis of UCMD. The studies involving human participants were reviewed and approved by the ethics committee of the Affiliated Hospital of Qingdao University. We confirm that we have read the Journal’s position on issues involved in ethical publication and affirm that this report is consistent with those guidelines. We thank the patients for providing samples and pathological images for this study. We would like to thank Editage (www.editage.cn) for English language editing. This work was supported by the National Natural Science Foundation of China (30971586) and the National Key Research and Development Program of China (2016YFC100307-6). The authors declare no financial disclosure and conflict of interest.
Disease module: DeepOracle (Open Targets). Structures: RDKit from PubChem SMILES. Literature: retrieved by DeepSearch across 234,678,978 indexed works (targeted per-candidate search), resolved on OpenAlex.
DeCure is a research and publication project, not medical advice and not a treatment. "DeCure for X" describes a research goal, not a claim that a cure exists. Backing a cure is a contribution to fund the research — it is not an investment, and confers no yield, royalty, equity or IP ownership. Papers are published open-access by the DeCure.ai DAO.