Rare & Orphan Lab · DeCure for X

DeCure for Rafiq syndrome

DeCure's autonomous Rare AI scientist is researching a drug-repurposing hypothesis for Rafiq syndrome — screening already-approved drugs against its 1-gene Open Targets disease module to publish open-access research. Research is fast; the path to publication is funded in milestone stages.

Disease module1 genesLead labRare & Orphan
All cures
Rare & OrphanDOID:0081097$DeCureRare

The disease map

Disease moduleRafiq syndrome maps to a 1-gene Open Targets module — the target space DeCure's AI scientist screens approved drugs against.
DeCure.ai methodSignature reversal (LINCS) plus network proximity (STRING) rank already-approved drugs likely to perturb this module — the same engine that produces DeCure.ai's repurposing hypotheses.
Repurposing thesisScreening approved medicines against this disease module, then publishing the evidence for the strongest candidate. Known pharmacology and human exposure data make the first question sharper — they do not establish safety or efficacy in a new indication.

Research record

01
ResearchComing soon
Candidate research + dossier — target rationale, drug-repurposing thesis and evidence pack.proof: Published dossier + on-chain hash
02
ValidationComing soon
In-vitro biological validation at a contract research org (CRO).proof: CRO contract + in-vitro report
03
Peer review & paperComing soon
Peer-reviewed paper published open-access (preprint + journal).proof: DOI + open-access link + on-chain hash

Current lead

No approved-drug candidate for rafiq syndrome is corroborated in the literature DeepSearch retrieved. Some conditions are managed with non-pharmacological care — a device, surgery or physical therapy — rather than a medicine; that may be the case here, or the literature we found may simply be too sparse yet to support a drug-repurposing angle.

Molecular view

mannosidase alpha class 1B member 1 (MAN1B1)MAN1B1 is one of the genes genetically linked to this disease in Open Targets — shown as context, not as a drug target we're pursuing: no approved-drug candidate for this disease is yet corroborated in the literature we found.

Loading structure…
helix sheet bu1drag to rotate · scroll to zoom

RCSB Protein Data Bank · entry 1X9D · 1.41 Å · ligand 1,4-BUTANEDIOL (BU1). Experimental structure, not a prediction.

What the evidence adds up to

A 2025 study of a consanguineous Pakistani family with multiple affected individuals identified a novel MAN1B1 mutation (c.772_775del) that co-segregated with Rafiq syndrome. Exome sequencing and homozygosity mapping were used. Knockdown of Man1b1 in cultured mouse excitatory neurons disrupted axon growth, dendrite formation, and spine maturation, and could not be rescued by truncated variants from the family. In utero electroporation in the murine cortex showed that Man1b1 knockdown impaired neural stem cell proliferation and differentiation, as well as cortical neuron migration. Public single-cell transcriptomic data indicated MAN1B1 is predominantly expressed in dorsal progenitors and intermediate excitatory neurons during human brain development. The authors concluded that loss-of-function mutation in MAN1B1 disrupts neurodevelopmental processes.

A separate 2025 case report described a patient with a homozygous c.1000 C>T (p.Arg334Cys) pathogenic variant in MAN1B1. The patient had feeding difficulty that began to improve after the fifth month and persistent hyperekplexia. The authors noted that feeding difficulty and hyperekplexia concomitant with MAN1B1 mutation had not been reported before. They stated that 45 patients with Rafiq syndrome had been reported in the literature to date. The clinical findings were mainly similar to previously reported patients, but the authors cautioned that more extensive case series are needed to determine whether these new features are part of the syndrome or incidental.

A 2025 case report from China described a patient with compound heterozygous MAN1B1 mutations (c.1281_1303del and c.2011C>T) and a heterozygous DUOX2 mutation (c.650A>G), the latter a variant of uncertain significance. The patient had thyroid dyshormonogenesis type 6 in addition to features consistent with Rafiq syndrome: distinctive facial features, borderline intellectual delay, truncal obesity, abnormal coagulation function, and abnormal electroencephalogram. The authors stated that just over 40 cases of Rafiq syndrome had been reported worldwide. They noted that this combination of genetic defects had not been previously reported.

No drug treatment or intervention for Rafiq syndrome is mentioned in any of these abstracts. What remains missing are any clinical trials, any tested therapies, any patient stratification by mutation type, and any funding for translational research. The underlying pathogenic mechanisms are still described as poorly understood.

Evidence

Retrieved by DeepSearch across 234,678,978 indexed works and resolved on OpenAlex — ranked by citations, including the results that did not work.

International Journal of Molecular Sciences · 2025 · 2 citations · open access

Bi-Allelic Loss-of-Function Variant in MAN1B1 Cause Rafiq Syndrome and Developmental Delay

AbstractRafiq syndrome (RAFQS) is a rare autosomal recessive disorder that is classified as a type II congenital disorder of glycosylation (CDG-II), and caused by MAN1B1 gene mutation. To date, 24 pathogenic MAN1B1 mutations have been reported in association with MAN1B1-CDG. However, the underlying pathogenic mechanisms remain poorly understood. In this study, we recruited a consanguineous family from Pakistan with multiple affected individuals exhibiting mild facial dysmorphism, developmental delay, and intellectual disability. Utilizing exome sequencing and homozygosity mapping, we identified a novel MAN1B1 mutation (c.772_775del) that co-segregated with RAFQS in this family. Analysis of public single-cell transcriptomic data revealed that MAN1B1 is predominantly expressed in dorsal progenitors and intermediate excitatory neurons during human brain development. Knockdown of Man1b1 in primarily cultured mouse excitatory neurons disrupted axon growth, dendrite formation, and spine maturation, and could not be rescued by truncated variants identified in the family. Furthermore, in utero, electroporation experiments revealed that Man1b1 knockdown in the murine cortex impaired neural stem cells’ proliferation and differentiation, as well as cortical neuron migration. Collectively, these findings elucidate a critical role for MAN1B1 in the etiology of RAFQS and demonstrate that loss-of-function mutation in MAN1B1 disrupt neuro-developmental processes, providing mechanistic insights into the pathogenesis of this disorder.

https://doi.org/10.3390/ijms26167820
PubMed · 2025 · 1 citations · open access

Rafiq Syndrome: Old Variant in MAN1B1 Gene and Some New Phenotypic Features.

AbstractRafiq syndrome is a congenital disorder of glycosylation type II that develops due to mutations in the Mannosidase Alpha Class 1B Member 1 (MAN1B1) gene encoding α 1,2-mannosidase. In the literature, 45 patients have been reported to date. This study presents a patient with some phenotypic traits that differ from previously reported patients with Rafiq syndrome.Since the patient was not diagnosed despite detailed examinations, whole exome sequencing was performed. The patientss' homozygous c.1000 C>T (p.Arg334Cys) pathogenic variant was detected in the MAN1B1 gene (NM_016219.5), which was consistent with Rafiq syndrome. Our patient's clinical findings were mainly similar to those of previously reported patients. However, our patient had feeding difficulty that started to improve after the fifth month and persistent hyperekplexia . Feeding difficulty and hyperekplexia concomitant to MAN1B1 gene mutation are reported for the first time. More extensive case series are needed to understand whether these findings are part of the syndrome or incidental comorbid conditions.

https://doi.org/10.22037/ijcn.v19i1.42376
Frontiers in Endocrinology · 2025 · 0 citations · open access

A new case of Rafiq syndrome with coexisting thyroid dyshormonogenesis type 6 in a Chinese patient: case report and literature review

AbstractRafiq syndrome is a rare autosomal recessive genetic disorder first described by Rafiq et al. in 2011.With an extremely low incidence rate, just over 40 cases have been reported worldwide. This condition is caused by mutations in the MAN1B1 gene, which encodes a member of the glycosyl hydrolase family 47.The primary clinical features of Rafiq syndrome include intellectual and motor developmental delay, distinctive facial features, truncal obesity, and hypotonia. We described a case of Rafiq syndrome with coexisting thyroid dyshormonogenesis type 6 in a Chinese Patient. The patient presented with distinctive facial features (small forehead, wide eye distance, small bilateral eye fissures, low nose bridge, protruding nose, short philtrum, small chin, large ears, short neck), borderline intellectual delay, truncal obesity, abnormal coagulation function, abnormal electroencephalogram, which were similar with the clinical manifestations of Rafiq syndrome reported in the literature. In addition to the above-mentioned abnormalities, the child also has thyroid dyshormonogenesis type 6. Genetic testing has identified compound heterozygous mutations in the MAN1B1 gene: c.1281_1303delCATCCACGCCTGTGTCTGGAAGA and c.2011C>T, and one heterozygous mutation in the DUOX2 gene: c.650A>G, which is new variant of uncertain clinical significance. The clinical manifestations and genetic testing of patients can help diagnose Rafiq syndrome. To the best of our knowledge, this combination of genetic defects is unique and has not been previously reported in the literature.

https://doi.org/10.3389/fendo.2025.1583011

Disease module: DeepOracle (Open Targets). Structures: RDKit from PubChem SMILES. Literature: retrieved by DeepSearch across 234,678,978 indexed works (targeted per-candidate search), resolved on OpenAlex.

DeCure is a research and publication project, not medical advice and not a treatment. "DeCure for X" describes a research goal, not a claim that a cure exists. Backing a cure is a contribution to fund the research — it is not an investment, and confers no yield, royalty, equity or IP ownership. Papers are published open-access by the DeCure.ai DAO.