DeCure's autonomous Rare AI scientist is researching a drug-repurposing hypothesis for aniridia — screening already-approved drugs against its 9-gene Open Targets disease module to publish open-access research. Research is fast; the path to publication is funded in milestone stages.
Disease moduleAniridia maps to a 9-gene Open Targets module — the target space DeCure's AI scientist screens approved drugs against.
DeCure.ai methodSignature reversal (LINCS) plus network proximity (STRING) rank already-approved drugs likely to perturb this module — the same engine that produces DeCure.ai's repurposing hypotheses.
Repurposing thesisScreening approved medicines against this disease module, then publishing the evidence for the strongest candidate. Known pharmacology and human exposure data make the first question sharper — they do not establish safety or efficacy in a new indication.
Research record
01
ResearchComing soon
Candidate research + dossier — target rationale, drug-repurposing thesis and evidence pack.proof: Published dossier + on-chain hash
02
ValidationComing soon
In-vitro biological validation at a contract research org (CRO).proof: CRO contract + in-vitro report
03
Peer review & paperComing soon
Peer-reviewed paper published open-access (preprint + journal).proof: DOI + open-access link + on-chain hash
Current lead
No approved-drug candidate for aniridia is corroborated in the literature DeepSearch retrieved. Some conditions are managed with non-pharmacological care — a device, surgery or physical therapy — rather than a medicine; that may be the case here, or the literature we found may simply be too sparse yet to support a drug-repurposing angle.
Molecular view
EPH receptor A2 (EPHA2) — EPHA2 is one of the genes genetically linked to this disease in Open Targets — shown as context, not as a drug target we're pursuing: no approved-drug candidate for this disease is yet corroborated in the literature we found.
Loading structure…
helix sheet acpdrag to rotate · scroll to zoom
RCSB Protein Data Bank · entry 7KJA · 1.75 Å · ligand PHOSPHOMETHYLPHOSPHONIC ACID ADENYLATE ESTER (ACP). Experimental structure, not a prediction.
What the evidence adds up to
Aniridia is a congenital panocular malformation defined by iris aplasia or hypoplasia, often accompanied by cataracts, glaucoma, corneal pannus, optic nerve hypoplasia, and lens dislocation. In the majority of cases the disease is caused by mutation in the PAX6 gene. A Polish family study used multiplex ligation probe amplification (MLPA) and array comparative genomic hybridization to identify a heterozygous deletion of approximately 0.6 Mb downstream of PAX6 on chromosome 11, spanning four genes, in a subset of cases where PAX6 sequencing itself revealed no causative alteration. The authors concluded that a "position effect" is the underlying pathogenic mechanism and recommended that molecular testing should include PAX6 sequencing followed by screening for larger structural abnormalities on chromosome 11p13.
Several novel PAX6 mutations have been identified in families from different populations. In a Chinese family, a heterozygous mutation (IVS10+1G>A) at the boundary of exon 10 and intron 10 was found in two patients but not in five healthy relatives or 100 unrelated controls. In a four-generation Iranian family, a novel heterozygous deletion c.320_348del (p.Leu107HisfsX16) was detected; real-time PCR showed decreased PAX6 mRNA levels in affected individuals, indicating nonsense-mediated mRNA decay. That Iranian pedigree included retinal detachment, a rare reported phenotypic feature. In another Chinese family, a heterozygous mutation (c.151 G>A) was identified in the proband and other affected members, and was absent from unaffected family members and 160 unrelated controls. Two cases of familial total aniridia associated with microcornea, high myopia and dislocated lens have also been described, with no systemic abnormality noted.
All reports confirm that aniridia is an autosomal dominant inheritable disease caused by PAX6 mutations or deletions, and that the genetic basis can vary between families. No drug treatment is mentioned in any of these abstracts. What remains missing is any large-scale, prospective trial that stratifies patients by specific PAX6 mutation type or deletion size, and any funded effort to develop molecular therapies that might address the underlying haploinsufficiency.
Evidence
Retrieved by DeepSearch across 234,678,978 indexed works and resolved on OpenAlex — ranked by citations, including the results that did not work.
Ophthalmic Genetics · 2011 · 30 citations
<i>PAX6</i>3′ deletion in a family with aniridia
AbstractBACKGROUND: Aniridia is a congenital panocular malformation defined as iris aplasia or hypoplasia. It can be either isolated or be a part of multiple ocular anomalies such as cataracts, glaucoma, corneal pannus, optic nerve hypoplasia, absence of macular reflex or ectopia lentis. In the majority of cases the disease is caused by mutation in the PAX6 gene. MATERIAL AND METHODS: A Polish family with aniridia was screened for the presence of genomic rearrangements in PAX6, WT1 and the flanking genes by means of multiplex ligation probe amplification (MLPA). MLPA reaction was performed using the P219-B1 PAX6 commercial kit from MRC-Holland. Additionally, the coding sequence of PAX6 gene was sequenced in the proband. Array comparative genomic hybridization analysis was performed using the NimbleGen CGX-12 format. RESULTS: MLPA examination revealed a heterozygous deletion of approximately 0.6 Mb, downstream of PAX6 gene on chromosome 11. Four genes lie in the deleted region. Bi-directional sequencing of 14 exons of the PAX6 gene did not reveal any causative alteration. Microarray analysis confirmed the deletion and determined its size which ranged from 598.87-651.76 kb. CONCLUSIONS: A small subset of aniridia cases is caused by rearrangements of PAX6 neighboring regions, and the so-called "position effect" is considered to be the underlying pathogenic mechanism. Molecular testing of aniridia patients should include sequencing of the PAX6 gene, followed by screening for larger structural abnormalities located on chromosome 11p13. MLPA can be a useful method in molecular testing of aniridia patients.
[A novel mutation of the PAX6 gene in a Chinese family with aniridia].
AbstractOBJECTIVE: The PAX6 gene encodes a transcriptional regulator involved in oculogenesis and other developmental processes such as aniridia, a congenital condition characterized by the underdevelopment of the iris of eyes. The function of the PAX6 gene in these two conditions is still poorly defined. The purpose of this study is to identify the mutation of the PAX6 gene in a Chinese family with aniridia. METHODS: Two aniridia patients collected from the family underwent full ophthalmologic examination. Genomic DNA was prepared from venous leukocytes of the two patients and five healthy individuals in the family, and 100 unrelated healthycontrols. Exons 4-13 and their immediate flanking sequences of the PAX6 gene was analyzed by PCR amplification, direct sequencing, and single-strand conformation polymorphism(SSCP). RESULTS: The sequencing result revealed a novel PAX6 mutation in the two patients. It was a heterozygous mutation (IVS10+1G>A) at the boundary of exon 10 and intron 10. The mutation was also detected by SSCP analysis. It was not detected in the healthy relatives and unrelated controls. CONCLUSION: Aniridia is an autosomal dominant inheritable disease. A novel PAX6 gene mutation has been identified in the Northeastern Chinese family with aniridia. The genetic analysis suggested that this novel mutation in the PAX6 gene is capable of causing the classic aniridia phenotype.
A novel <i>PAX6</i> mutation causes congenital aniridia with or without retinal detachment
AbstractBACKGROUND: Aniridia is a rare developmental eye disorder characterized by complete or partial iris hypoplasia often accompanied with other ocular changes that affect the cornea, anterior chamber, lens, retina, and optic nerve. Most cases of aniridia are inherited with an autosomal dominant mode of inheritance caused by PAX6 mutations or deletions. To reveal the underlying genetic defect in a four-generation Iranian family with aniridia, we carried out a genetic screening of PAX6. METHODS: Complete ophthalmic examinations were performed for available affected family members. All PAX6 exons and their flanking regions were sequenced for affected individuals. Candidate variation was screened for segregation in the pedigree by Sanger sequencing. Bioinformatics prediction was done to evaluate the deleterious effects of the mutation on protein product. Real-time PCR was used to investigate the impact of the variant on PAX6 mRNA expression. RESULTS: All patients were diagnosed with isolated aniridia associated with variable phenotypic features including retinal detachment. A novel heterozygous deletion c.320_348delTGTCCGAGGGGGTCTGTACCAACGATAAC (p.Leu107HisfsX16) on PAX6 gene was detected. Decreased mRNA level of PAX6 in the affected individuals indicated that the mutation caused nonsense-mediated mRNA decay (NMD). CONCLUSIONS: To the best of our knowledge, it is the first report on the genetics of aniridia in Iran. Segregation analysis, bioinformatics prediction and confirmation of NMD, all support the proposition that the novel observed PAX6 mutation is the cause of aniridia in the pedigree. Retinal detachment in some of the affected members, which is a rare reported phenotypic feature of aniridia patients, may be associated with this mutation.
[Analysis of PAX6 gene mutations in a Chinese family affected with congenital aniridia].
AbstractOBJECTIVE: To investigate the mutation of PAX6 gene in a Chinese family affected with congenital aniridia. METHODS: Blood samples were drawn from family members, and DNA was analyzed by direct sequencing. RESULTS: A heterozygous mutation (c.151 G>A) was identified in the PAX6 gene in the proband and other patients from the family. The same mutation was not found among unaffected family members and 160 unrelated healthy controls. CONCLUSION: A novel mutation in the PAX6 gene has been identified in a Chinese family affected with aniridia.
Middle East African Journal of Ophthalmology · 2014 · 1 citations
Rare association of familial aniridia, microcornea with myopia and aphakia
AbstractAniridia is a rare congenital malformation that may be associated with various ocular and systemic manifestations. We describe two cases of familial total aniridia associated with microcornea, high myopia and dislocated lens. No systemic abnormality was noted in any of the cases.
Disease module: DeepOracle (Open Targets). Structures: RDKit from PubChem SMILES. Literature: retrieved by DeepSearch across 234,678,978 indexed works (targeted per-candidate search), resolved on OpenAlex.
DeCure is a research and publication project, not medical advice and not a treatment. "DeCure for X" describes a research goal, not a claim that a cure exists. Backing a cure is a contribution to fund the research — it is not an investment, and confers no yield, royalty, equity or IP ownership. Papers are published open-access by the DeCure.ai DAO.
